What is beneficial raw oil

Use of hydrophobin as a phase stabilizer

description

The present invention relates to the use of hydrophobin and / or one of its derivatives for stabilizing phases in compositions containing at least two liquid phases, in particular oil and water.

Hydrophobins are small proteins of around 100 to 150 amino acids that are characteristic of filamentous fungi, for example Schizophyllum commune. As a rule, they have 8 cysteine ​​units.

Hydrophobins have a pronounced affinity for interfaces and are therefore suitable for coating surfaces in order to change the properties of the interfaces by forming amphiphatic membranes. For example, Teflon can be coated with hydrophobins while maintaining a hydrophilic surface.

Hydrophobins can be isolated from natural sources. Production processes for hydrophobins and derivatives thereof are also known. For example, the German patent application DE 10 2005 007 480 discloses a production process for hydrophobins and derivatives thereof.

The use of hydrophobins for various applications has already been proposed in the prior art.

WO 96/41882 proposes the use of hydrophobins as emulsifiers, thickeners, surface-active substances, for making hydrophobic surfaces hydrophilic, for improving the water resistance of hydrophilic substrates, for producing oil-in-water emulsions or water-in-oil emulsions. Furthermore, pharmaceutical applications such as the production of ointments or creams and cosmetic applications such as skin protection or the production of hair shampoos or hair conditioners are proposed. WO 96/41882 also describes compositions, in particular compositions for pharmaceutical applications, containing hydrophobins. EP-A 1 252 516 discloses the coating of windows, contact lenses, biosensors, medical devices, containers for carrying out experiments or for storage, ship hulls, solid particles or frames or bodies of passenger cars with a solution containing hydrophobins at a temperature of 30 to 800C.

WO 03/53383 describes the use of hydrophobin for treating keratin materials in cosmetic applications.

WO 03/10331 discloses that hydrophobins have surface-active properties. For example, a hydrophobin-coated sensor is presented, for example a measuring electrode to which other substances, e.g. electroactive substances, antibodies or enzymes, are non-covalently bound.

WO 2004/000880 also relates to the coating of surfaces with hydrophobin or hydrophobin-like substances.

WO 01/74864, which relates to hydrophobin-like proteins, also discloses that these can be used to stabilize dispersions and emulsions.

The use of proteins for phase separation is known in principle.

For example, EP-A 05 016 962 describes the use of proteins to improve the phase separation of, for example, oil / water or fuel / water mixtures. The person skilled in the art knows that amphiphilic molecules can have both a stabilizing and a destabilizing effect on phase boundaries, depending on the application concentration and the surrounding medium.

GB 195,876 discloses a method of breaking water-in-oil emulsions using colloids. Proteins such as gelatin, casein, albumin or polysaccharides such as gum arabic or gum tragacanth are mentioned as examples of colloids.

JP-A 11-169177 describes the use of proteins with lipase activity for breaking emulsions.

WO 01/60916 discloses the use of surfactant-free mixtures of at least one water-soluble protein, at least one water-soluble polysaccharide and at least one water-soluble polymer such as polyethylene oxide for various applications, including for demulsifying crude oil. None of the documents cited discloses the use of hydrophobins to prevent re-emulsification.

The use of proteins has the general advantage that they are naturally occurring substances that are biodegradable and therefore do not lead to permanent pollution of the environment.

In many industrial-scale applications, for example in the separation of crude oil-water emulsions, it is important on the one hand to achieve phase separation as quickly as possible and, on the other hand, to avoid or prevent re-emulsification of the phases. The object of the invention was to provide an improved process for stabilizing the phases by using proteins.

According to the invention, this object is achieved by the use of at least one hydrophobin in compositions containing at least two liquid phases, in particular oil and water.

According to the invention, the hydrophobin can in principle be used in any amount as long as it is ensured that the phase stabilization in the compositions containing at least two liquid phases is improved.

In the context of the present invention, “improvement of the phase stabilization” is understood to mean that the re-emulsification of two liquid phases when a substance is added to a mixture takes place more slowly than in the same mixture without the addition of the substance or as a result of the addition of the substance the re-emulsification of two liquid phases is avoided.

In the context of the present invention, a hydrophobin is also understood to mean derivatives thereof or modified hydrophobins. Modified or derivatized hydrophobins can be, for example, hydrophobin fusion proteins or proteins that have an amino acid sequence that is at least 60%, for example at least 70%, in particular at least 80%, particularly preferably at least 90%, particularly preferably at least 95% identity with the sequence of a hydrophobin, and which still meet 50%, for example 60%, in particular 70%, particularly preferably 80%, the biological properties of a hydrophobin, in particular the property that the surface properties are changed in this way by coating with these proteins be that the contact angle of a water drop before and after coating a glass surface with the protein is enlarged by at least 20 °, preferably by at least 25 °, in particular by at least 30 °.

It has surprisingly been found that hydrophobins or derivatives thereof reduce or prevent the formation of new emulsions after phase separation has taken place. This is particularly advantageous if there is a longer coexistence of two phases next to one another or the occurrence of new emulsions is to be prevented. Even small amounts of the peptide are extremely effective here.

The structure and not the sequence specificity of the hydrophobins is decisive for the definition of hydrophobins. The amino acid sequence of the natural hydrophobins is very diverse, but they all have a highly characteristic pattern of 8 conserved cysteine ​​residues. These residues form four intramolecular disulfide bridges.

The N- and C-terminus is variable over a larger area. Here, using molecular biological techniques known to the person skilled in the art, fusion partner proteins with a length of 10 to 500 amino acids can be added.

In addition, in the context of the present invention, hydrophobins and derivatives thereof are to be understood as meaning proteins with a similar structure and functional equivalence.

The term "hydrophobin" in the context of the present invention is intended below to mean polypeptides of the general structural formula (I)

Xn-C -Xi_5o-C -Xo-5-C -Xi-ioo-C -Xi_ioo-C -Xi_5o-C -X0-S-C -Xi-S0-C -Xm (I)

be understood, where X for each of the 20 naturally occurring amino acids (Phe, Leu, Ser, Tyr, Cys, Trp, Pro, His, GIn, Arg, Ne Met, Thr, Asn, Lys, VaI, AIa, Asp, GIu, GIy) can stand. X can in each case be the same or different. The indices at X represent the number of amino acids, C stands for cysteine, alanine, serine, glycine, methionine or threonine, with at least four of the radicals named C stand for cysteine, and the indices n and m stand independently of one another for natural numbers between 0 and 500, preferably between 15 and 300.

The polypeptides according to formula (I) are further characterized by the property that at room temperature after coating a glass surface they cause an enlargement of the contact angle of a water droplet of at least 20 °, preferably at least 25 ° and particularly preferably 30 °, in each case compared to that Contact angle of an equally large drop of water with the uncoated glass surface.

The ones with C1 to C8 named amino acids are preferably cysteines; however, they can also be replaced by other amino acids with similar space filling, preferably by alanine, serine, threonine, methionine or glycine. However, at least four, preferably at least 5, particularly preferably at least 6 and in particular at least 7 of the C positions1 to C8 consist of cysteines. Cysteines can either be present in reduced form in the proteins according to the invention or form disulfide bridges with one another. The intramolecular formation of C-C bridges is particularly preferred, in particular those with at least one, preferably 2, particularly preferably 3 and very particularly preferably 4 intramolecular disulfide bridges. In the above-described exchange of cysteines by amino acids of similar space filling, those C positions are advantageously exchanged in pairs which can form intramolecular disulfide bridges with one another.

If cysteines, serines, alanines, glycines, methionines or threonines are also used in the positions marked X, the numbering of the individual C positions in the general formulas can change accordingly.

Hydrophobins of the general formula (II) are preferred

Xn-C -X3-25-C -Xθ-2 "C -X5-50-C -X2-35" C -X2-15 "C -Xθ-2" C -X3-35 "C -Xm (H)

used to carry out the present invention, where X, C and the indices standing at X and C have the above meaning, the indices n and m stand for numbers between 0 and 300, and the proteins are further characterized by the contact angle change mentioned above, and Furthermore, at least 6 of the residues named with C are cysteine. It is particularly preferable for all of the C residues to be cysteine.

Hydrophobins of the general formula (IM) are particularly preferred

Xn "C -Xö-g-C -C -Xn-39-C -X2-23"C -Xδ-g-C -C -Xß-Iδ-C -Xm (Hl)

used, where X, C and the indices at X have the above meaning, the indices n and m stand for numbers between 0 and 200, the proteins are still characterized by the above-mentioned change in contact angle, and at least 6 of the residues named with C are cysteine. It is particularly preferable for all of the C residues to be cysteine.

The remnants of Xn and Xm it can be peptide sequences that are naturally also linked to a hydrophobin. However, one or both residues can also be peptide sequences which are not naturally linked to a hydrophobin. These include such residues Xn and / or Xm to understand in which a peptide sequence naturally occurring in a hydrophobin is extended by a peptide sequence which is not naturally occurring in a hydrophobin.

If Xn and / or Xn, peptide sequences not naturally linked in hydrophobins are involved, such sequences are generally at least 20, preferably at least 35, particularly preferably at least 50 and very particularly preferably at least 100 amino acids long. Such a residue which is not naturally linked to a hydrophobin is also to be referred to below as a fusion partner. This is to express that the proteins can consist of at least one hydrophobin part and one fusion partner part, which do not occur together in this form in nature.

The fusion partner portion can be selected from a variety of proteins. Several fusion partners can also be linked with a hydrophobin part, for example at the amino terminus (Xn) and at the carboxy terminus (Xn,) of the hydrophobic part. However, it is also possible, for example, to have two fusion partners with one position (Xn or Xn,) of the protein according to the invention are linked.

Particularly suitable fusion partners are proteins which occur naturally in microorganisms, in particular in E. coli or Bacillus subtilis. Examples of such fusion partners are the sequences yaad (SEQ ID NO: 15 and 16), yaae (SEQ ID NO: 17 and 18), and thioredoxin. Fragments or derivatives of these sequences mentioned are also very suitable which comprise only a part, for example 70 to 99%, preferably 5 to 50%, and particularly preferably 10 to 40% of the sequences mentioned, or in which individual amino acids or nucleotides are opposite to the ones mentioned Sequence are changed, the percentages referring to the number of amino acids.

In a further preferred embodiment, the fusion hydrophobin has X as a group in addition to the fusion partnern or Xn, another so-called affinity domain (affinity tag / affinity tail). In a manner known in principle, these are anchor groups which can interact with certain complementary groups and can serve to facilitate processing and purification of the proteins. Examples of such affinity domains include (His)k-, (Arg)k-, (Asp)k-, (Phe)k- or (Cys)k-Groups, where k is generally a natural number from 1 to 10. It can preferably be a (His)k-Group, where k is 4 to 6.

The proteins used according to the invention as hydrophobins or derivatives thereof can also be modified in their polypeptide sequence, for example by glycosylation, acetylation or also by chemical crosslinking, for example with glutaraldehyde.

One property of the hydrophobins or their derivatives used according to the invention is the change in surface properties when the surfaces are coated with the proteins. The change in the surface properties can be determined experimentally, for example, by measuring the contact angle of a water droplet before and after coating the surface with the protein and determining the difference between the two measurements.

Carrying out contact angle measurements is known in principle to the person skilled in the art. The measurements relate to room temperature and water droplets of 5 μl and the use of glass plates as a substrate. The exact experimental conditions for an exemplary suitable method for measuring the contact angle are shown in the experimental section. Under the conditions mentioned there, the fusion proteins used according to the invention have the property of increasing the contact angle by at least 20 °, preferably at least 25 °, particularly preferably at least 30 °, in each case compared to the contact angle of an equally large water drop with the uncoated glass surface.

Particularly preferred hydrophobins for carrying out the present invention are the hydrophobins of the type dewA, rodA, hypA, hypB, sc3, basfi, basf2, which are structurally characterized in the sequence listing below. It can also only be parts or derivatives thereof. Several hydrophobin parts, preferably 2 or 3, of the same or different structure can also be linked to one another and linked to a corresponding suitable polypeptide sequence which is not naturally linked to a hydrophobin.

The fusion proteins yaad-Xa-dewA-his (SEQ ID NO: 20), yaad-Xa-rodA-his (SEQ ID NO: 22) or yaad-Xa-basf 1-his (SEQ ID NO: 24) with the polypeptide sequences given in brackets and the nucleic acid sequences coding therefor, in particular the sequences according to SEQ ID NO: 19, 21, 23. Proteins that are derived from the sequences shown in SEQ ID NO. 20, 22 or 24 represented polypeptide sequences by exchange, insertion or deletion of at least one, up to 10, preferably 5, particularly preferably 5% of all amino acids and which still have the biological property of the starting proteins to at least 50% particularly preferred embodiments. The biological property of the proteins is understood here to mean the change in the contact angle by at least 20 °, which has already been described.

Particularly suitable derivatives for carrying out the invention are of yaad-Xa-dewA-his (SEQ ID NO: 20), yaad-Xa-rodA-his (SEQ ID NO: 22) or yaad-Xa-basf 1 -his (SEQ

ID NO: 24) residues derived by truncation of the yaad fusion partner. Instead of the complete yaad fusion partner (SEQ ID NO: 16) with 294 amino acids, a shortened yaad residue can advantageously be used. The shortened residue should, however, comprise at least 20, preferably at least 35 amino acids. For example, a shortened remainder with 20 to 293, preferably 25 to 250, particularly preferably 35 to

150 and for example 35 to 100 amino acids can be used.

A cleavage point between the hydrophobin and the fusion partner or the fusion partners can be used to release the pure hydrophobin in an underivatized form (for example by BrCN cleavage on methionine, factor Xa, enterokinase, thrombin, TEV cleavage, etc.).

It is also possible to generate fusion proteins from a fusion partner, for example yaad or yaae, and several hydrophobins, also of different sequences, for example DewA-RodA or Sc3-DewA, Sc3-RodA), one after the other. Likewise, hydrophobin fragments (for example N- or C-terminal truncations) or muteins, which have up to 70% homology, can be used. The selection of the optimal constructs is made in relation to the respective use, i.e. the liquid phases to be separated.

The hydrophobins used according to the invention or the hydrophobins contained in the formulations according to the invention can be produced chemically by known methods of peptide synthesis, for example by solid-phase synthesis according to Merrifield.

Naturally occurring hydrophobins can be isolated from natural sources using suitable methods. An example is Wösten et. al., Eur. J Cell Bio. 63, 122-129 (1994) or WO 96/41882. Fusion proteins can preferably be produced by genetic engineering methods in which a nucleic acid sequence coding for the fusion partner and a nucleic acid sequence coding for the hydrophobin part, in particular a DNA sequence, are combined in such a way that the desired protein is produced in a host organism by gene expression of the combined nucleic acid sequence . Such a production method is disclosed, for example, in German patent application DE 102005007480.4.

Suitable host organisms (production organisms) for the manufacturing process mentioned can be prokaryotes (including the archaea) or eukaryotes, especially bacteria including halobacteria and methanococci, fungi, insect cells, plant cells and mammalian cells, particularly preferably Escherichia coli, Bacillus subtilis, Bacillus megaterium, Aspergillus oryz Aspergillus nidulans, Aspergillus niger, Pichia pastoris, Pseudomonas spec, Lactobacilli, Hansenula polymorpha, Trichoderma reesei, SF9 (or related cells) and others.

The work also relates to the use of expression constructs containing, under the genetic control of regulatory nucleic acid sequences, a nucleic acid sequence coding for a polypeptide used according to the invention, as well as vectors comprising at least one of these expression constructs.

Constructs used preferably comprise a promoter 5 "upstream of the respective coding sequence and a terminator sequence 3" downstream and, if appropriate, further customary regulatory elements, in each case operatively linked to the coding sequence.

In the context of the present invention, an “operative link” is understood to mean the sequential arrangement of promoter, coding sequence, terminator and optionally further regulatory elements in such a way that each of the regulatory elements can fulfill its intended function in the expression of the coding sequence.

Examples of operatively linkable sequences are targeting sequences and also enhancers, polyadenylation signals and the like. Further regulatory elements include selectable markers, amplification signals, origins of replication and the like. Suitable regulatory sequences are e.g. As described in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).

In addition to these regulatory sequences, the natural regulation of these sequences can still be present before the actual structural genes and, if necessary, have been genetically modified so that the natural regulation was switched off and the expression of the genes increased.

A preferred nucleic acid construct advantageously also contains one or more so-called “enhancer” sequences, functionally linked to the promoter, which enable increased expression of the nucleic acid sequence. Additional advantageous sequences, such as further regulatory elements or terminators, can also be inserted at the 3 "end of the DNA sequences.

The nucleic acids can be contained in one or more copies in the construct. The construct can also contain further markers, such as antibiotic resistance or genes complementing auxotrophies, optionally for selection for the construct.

Advantageous regulatory sequences for the production are, for example, in promoters such as cos-, tac-, trp-, tet-, trp-tet-, Ipp-, lac-, Ipp-lac-, Iaclq-T7-, T5-, T3-, gal -, trc, ara, rhaP (rhaPBAD) SP6, lambda-PR or imlambda-P promoters, which are advantageously used in gram-negative bacteria. Further advantageous regulatory sequences are contained, for example, in the gram-positive promoters amy and SP02, in the yeast or fungal promoters ADC1, MFalpha, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH.

Artificial promoters can also be used for regulation.

For expression in a host organism, the nucleic acid construct is advantageously inserted into a vector, such as, for example, a plasmid or a phage, which enables optimal expression of the genes in the host. In addition to plasmids and phages, vectors also include all other vectors known to the person skilled in the art, ie z. B. viruses such as SV40, CMV, baculovirus and adenovirus, TransposonsJS elements, phasmids, cosmids, and linear or circular DNA, as well as the Agrobacterium system.

These vectors can be replicated autonomously in the host organism or replicated chromosomally. Suitable plasmids are, for example, in E. coli pLG338, pACYC184, pBR322, pUC18, pUC19, pKC30, pRep4, pHS1, pKK223-3, pDHE19.2, pHS2, pPLc236, pMBL24, pLG200, pUR290, pN-IIIlI3-B1, tgt11 or pBdCI, in Streptomyces piJ101, piJ364, piJ702 or piJ361, in Bacillus pUB110, pC194 or pBD214, in Corynebacterium pSA77 or pAJ667, in fungi pALS1, piL2 or pBB116, in yeast YEp6, YEp13 or pEMBLYe23 or in plants pLGV23, pGHIac +, pBIN19, pAK2004 or pDH51. The plasmids mentioned represent a small selection of the possible plasmids. Further plasmids are known to the person skilled in the art and can be found, for example, in the book Cloning Vectors (Eds. Pouwels PH et al. Elsevier, Amsterdam-New York-Oxford, 1985, ISBN 0 444 904018) can be removed. Advantageously, the nucleic acid construct for expressing the other genes it contains also contains 3 ″ -and / or δ′-terminal regulatory sequences to increase expression, which are selected for optimal expression depending on the host organism and gene or genes selected.

These regulatory sequences are intended to enable the targeted expression of the genes and protein expression. Depending on the host organism, this can mean, for example, that the gene is only expressed or overexpressed after induction, or that it is expressed and / or overexpressed immediately.

The regulatory sequences or factors can preferably have a positive influence on the gene expression of the introduced genes and thereby increase it. Thus, the regulatory elements can advantageously be strengthened at the transcription level by using strong transcription signals such as promoters and / or “enhancers”. In addition, however, the translation can also be enhanced, for example by improving the stability of the mRNA.

In a further embodiment of the vector, the vector containing the nucleic acid construct or the nucleic acid can also advantageously be introduced into the microorganisms in the form of a linear DNA and integrated into the genome of the host organism via heterologous or homologous recombination. This linear DNA can consist of a linearized vector such as a plasmid or only of the nucleic acid construct or the nucleic acid.

For optimal expression of heterologous genes in organisms, it is advantageous to change the nucleic acid sequences in accordance with the specific “codon usage” used in the organism. The “codon usage” can easily be determined on the basis of computer evaluations of other, known genes of the organism in question.

An expression cassette is produced by fusing a suitable promoter with a suitable coding nucleotide sequence and a terminator or polyadenylation signal. For this purpose, common recombination and cloning techniques are used, such as those described, for example, in T. Maniatis, EFFritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, CoId Spring Harbor Laboratory, CoId Spring Harbor, NY (1989) and in TJ Silhavy, ML Berman and LW Enquist, Experiments with Gene Fusions, CoId Spring Harbor Laboratory, CoId Spring Harbor, NY (1984) and in Ausubel, FM et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987).

For expression in a suitable host organism, the recombinant nucleic acid construct or gene construct is advantageously inserted into a host-specific vector which enables optimal expression of the genes in the host. Vectors are well known to the person skilled in the art and can be taken, for example, from "Cloning Vectors" (Pouwels P. H. et al., Ed., Elsevier, Amsterdam-New York-Oxford, 1985).

With the help of the vectors, recombinant microorganisms can be produced which, for example, have been transformed with at least one vector and can be used for the production of the hydrophobins or derivatives thereof used according to the invention. The recombinant constructs described above are advantageously introduced into a suitable host system and expressed. Conventional cloning and transfection methods known to the person skilled in the art, such as, for example, co-precipitation, protoplast fusion, electroporation, retroviral transfection and the like, are preferably used in order to bring the said nucleic acids to expression in the respective expression system. Suitable systems are described, for example, in Current Protocols in Molecular Biology, F. Ausubel et al., Eds., Wiley Interscience, New York 1997, or Sambrook et al. Molecular Cloning: A Laboratory Manual. 2nd Ed., CoId Spring Harbor Laboratory, CoId Spring Harbor Laboratory Press, CoId Spring Harbor, NY, 1989.

Homologously recombined microorganisms can also be produced. For this purpose, a vector is produced which contains at least a section of a gene to be used or a coding sequence, in which at least one amino acid deletion, addition or substitution has been introduced in order to change the sequence, e.g. The sequence introduced can, for example, also be a homologue from a related microorganism or be derived from a mammalian, yeast or insect source. The vector used for the homologous recombination can alternatively be designed in such a way that the endogenous gene is mutated or otherwise changed in the case of homologous recombination, but still encodes the functional protein (for example the upstream regulatory region can be changed in such a way that the expression of the endogenous protein is changed as a result) The modified section of the gene used according to the invention is in the homologous recombination vector. The construction of suitable vectors for homologous recombination is described, for example, in Thomas, KR and Capecchi, MR (1987) Cell 51: 503. Acid constructs are principally all prokaryotic or eukar yontic organisms in question. Microorganisms such as bacteria, fungi or yeasts are advantageously used as host organisms. Gram-positive or gram-negative bacteria, preferably bacteria of the families Enterobacteriaceae, Pseudomonadaceae, Rhizobiaceae, Streptomycetaceae or Nocardiaceae, particularly preferably bacteria of the genera Escherichia, Pseudomonas, Streptomyces, Nocardia, Burkholderia, Salmonella, are used advantageously.

The organisms used in the above-described manufacturing process for fusion proteins are grown or grown in a manner known to the person skilled in the art, depending on the host organism. Microorganisms are usually in a liquid medium that contains a carbon source usually in the form of sugars, a nitrogen source usually in the form of organic nitrogen sources such as yeast extract or salts such as ammonium sulfate, trace elements such as iron, manganese and magnesium salts and possibly vitamins, at temperatures between 0 and 100 0C, preferably between 10 to 60 0C attracted under oxygen gassing. The pH value of the nutrient fluid can be kept at a fixed value, i.e. it can be regulated or not during cultivation. The cultivation can take place “batch”, “semibatch” or continuously. Nutrients can be presented at the beginning of the fermentation or added semi-continuously or continuously. The enzymes can be isolated from the organisms by the method described in the examples or used as crude extract for the reaction.

The hydrophobins or functional, biologically active fragments thereof used according to the invention can be produced by means of a method for recombinant production, whereby a polypeptide-producing microorganism is cultivated, the expression of the proteins is optionally induced and these are isolated from the culture. The proteins can also be produced in this way on an industrial scale, if this is desired. The recombinant microorganism can be cultivated and fermented according to known methods. Bacteria can, for example, be propagated in TB or LB medium and at a temperature of 20 to 40 ° C and a pH of 6 to 9. Suitable cultivation conditions are described in detail, for example, in T. Maniatis, E. F. Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, CoId Spring Harbor Laboratory, CoId Spring Harbor, NY (1989).

If the proteins are not secreted into the culture medium, the cells are then disrupted and the product is obtained from the lysate using known protein isolation methods. The cells can alternatively by high-frequency ultrasound, by high pressure, such as. B. in a French pressure cell, by osmolysis, by the action of detergents, lytic enzymes or organic solvents, by homogenizers or by a combination of several of the processes listed.

The proteins can be purified using known chromatographic methods, such as molecular sieve chromatography (gel filtration), such as Q-Sepharose chromatography, ion exchange chromatography and hydrophobic chromatography, as well as other conventional methods such as ultrafiltration, crystallization, salting out, dialysis and native gel electrophoresis. Suitable processes are described, for example, in Cooper, F. G., Biochemical Working Methods, Verlag Water de Gruyter, Berlin, New York or in Scopes, R., Protein Purification, Springer Verlag, New York, Heidelberg, Berlin.

It can be particularly advantageous to provide the fusion hydrophobins with special anchor groups, which can bind to corresponding complementary groups on solid supports, in particular suitable polymers, in order to facilitate isolation and purification. Such solid supports can be used, for example, as a filling for chromatography columns, and in this way the efficiency of the separation can generally be increased significantly. Such separation processes are also known as affinity chromatography. To incorporate the anchor groups in the production of the proteins, vector systems or oligonucleotides can be used which extend the cDNA by certain nucleotide sequences and thus code modified proteins or fusion proteins. Proteins modified for easier cleaning include so-called “tags” functioning as anchors, such as the modification known as hexa-histidine anchors. Fusion hydrophobins modified with histidine anchors can, for example, be purified chromatographically using nickel sepharose as the column filling. The fusion hydrophobin can then be eluted again from the column by means of suitable eluting means, such as, for example, an imidazole solution.

In a simplified purification process, chromatographic purification can be dispensed with. For this purpose, the cells are first separated from the fermentation broth by means of a suitable method, for example by microfiltration or by centrifugation. The cells can then be disrupted by means of suitable methods, for example by means of the methods already mentioned above, and the cell debris can be separated from the inclusion bodies. The latter can advantageously be done by centrifugation. Finally, the inclusion bodies can be opened up in a manner known in principle in order to release the fusion hydrophobins. This can be done, for example, by means of acids, bases and / or detergents. The inclusion bodies with the fusion hydrophobins used according to the invention can generally be completely dissolved within about 1 hour using 0.1 M NaOH. The purity of the fusion hydrophobins obtained by this simplified process is generally from 60 to 80% by weight, based on the amount of all proteins. The solutions obtained by the simplified purification process described can be used for carrying out this invention without further purification.

The hydrophobins prepared as described can be used both directly as fusion proteins and, after cleavage and separation of the fusion partner, as “pure” hydrophobins.

If the fusion partner is to be separated, it is advisable to incorporate a potential cleavage site (specific recognition site for proteases) in the fusion protein between the hydrophobin part and the fusion partner part. Particularly suitable as cleavage sites are those peptide sequences that are otherwise neither in the hydrophobin part nor in the fusion partner part, which can easily be determined with bioinformatic tools. For example, BrCN cleavage at methionine or protease-mediated cleavage with factor Xa, enterokinase, thrombin, TEV cleavage (Tobacca etch virus protease) are particularly suitable.

According to the invention, the hydrophobins or derivatives thereof can be used to stabilize the phases which have already been separated in compositions comprising at least two liquid phases. In principle, any compositions can be used, as long as they have at least two liquid phases.

In particular, they can also be compositions which were present in the form of an emulsion before the addition of the at least one hydrophobin or derivative thereof, then in a longer process (preferably more than 1 minute, in particular more than 5 minutes) in two phases were separated and only then are treated with hydrophobin.

In the context of the present invention, the composition can in principle also have further phases in addition to the at least two liquid phases.

The at least two liquid phases are two liquid phases of different density, preferably an oil and water, two organic solutions of different density, a fuel and water, a fuel and water or a solvent and water. In the context of the present invention, an aqueous solution is understood to mean solutions which contain water, optionally in combination with a further solvent. Each of the liquid phases can contain further substances within the scope of the present invention.

According to the invention, an oil is preferably a crude oil.

Suitable solvents are all liquids that form two-phase mixtures with water, in particular organic solvents, for example ethers, aromatic compounds such as toluene or benzene, alcohols, alkanes, alkenes, cycloalkanes, cycloalkenes, esters, ketones, naphthens or halogenated hydrocarbons.

According to a further embodiment, the present invention therefore relates to a use as described above of at least one hydrophobin or at least one derivative thereof, the composition containing oil, preferably crude oil and water, or fuel and water.

In the context of the present invention, the composition can also contain further phases, for example a solid or liquid phase, in particular a solid phase.

The hydrophobins or derivatives thereof can be used for all applications known to the person skilled in the art. In particular, within the scope of the present invention, use as a phase stabilizer in gasoline / water mixtures, in other fuel or fuel / water mixtures, crude oil and water phases in crude oil production or crude oil transport and the desalination of crude oil by extraction of crude oil with water as well as the subsequent transfer of the resulting phases.

By adding demulsifiers, emulsions can be broken. For example, extracted crude oil is usually in the form of a relatively stable water-in-oil emulsion which, depending on the type of deposit, can contain up to 90% by weight of water. When working up and purifying the crude oil, after a large part of the water has been separated off, a crude oil is obtained which still contains approx. 2 to 3% by weight of water. This forms a stable emulsion with the oil, which cannot be completely separated even by centrifugation and the addition of conventional demulsifiers. This is problematic insofar as the water is, on the one hand, very salty and thus has a corrosive effect, and on the other hand, the volume to be transported and stored is increased by the residual water, which leads to increased costs. It has been found that hydrophobins or derivatives thereof can be used to improve the phase separation in these compositions. A very quick separation is achieved.

The demulsifier must be adjusted to the type of emulsified oils and fats as well as to any emulsifiers and surfactants it may contain in order to achieve an optimal effect. The breaking of emulsions can be additionally assisted by an elevated temperature, for example a temperature from 0 to 100.degree. C., for example from 10 to 80.degree. C., in particular from 20 to 60.degree.

Another application according to the invention is phase stabilization in oil-in-water or water-in-oil mixtures, for example 2-phase systems, which were used as cooling lubricants and are to be recycled. For example, water / oil mixtures also occur on board seagoing vessels as bilge water. It is necessary to separate emulsions and maintain the separate phases in order to be able to reliably separate off the water.

The amount of the hydrophobin or derivative thereof used can vary within wide ranges, the amount advantageously being matched to the composition per se and, if appropriate, to further components contained in the composition.

If, for example, the composition contains substances which delay or worsen a phase separation of the at least two liquid phases, for example surfactants or emulsifiers, a larger amount of a hydrophobin or a derivative thereof is advantageously used.

Since oils, especially crude oils, consist of a mixture of many chemical compounds, it is necessary due to the different chemical composition of the oil, the water and salt components and the specific conditions of the emulsion breakdown, such as temperature, duration of emulsion breakdown, type of metering and interactions with other components of the mixture to adapt the demulsifier to the specific conditions.

It has surprisingly been found that even small amounts of a hydrophobin or derivative thereof lead to an improvement in the phase stabilization.

According to the invention, the hydrophobin or derivative thereof can be used in any suitable amount. As a rule, the at least one hydrophobin or derivative thereof is used in an amount of 0.001 to 100 ppm, based on the total composition; preferably in an amount from 0.001 to 80 ppm, particularly preferably from 0.001 to 20 ppm and very particularly preferably from 0.01 to 10 ppm.

In the context of the present application, the specification refers to ppm mg per kg.

Therefore, according to a further embodiment, the present invention relates to a use as described above, the hydrophobin or the at least one derivative thereof being used in an amount of 0.001 to 100 ppm, based on the total composition. The concentration used is determined by the specialist depending on the type of phase composition to be stabilized.

If the composition is a composition containing fuels or fuels and water, the hydrophobin or derivative thereof is generally used in an amount from 0.001 to 20 ppm, preferably from 0.005 to 2 ppm, in particular from 0.01 to 1 ppm, particularly preferably 0.05 to 1 ppm, are used.

If the composition is a composition containing crude oil and water, the hydrophobin or derivative thereof is generally used in an amount from 0.01 to 100 ppm, preferably from 0.1 to 80 ppm, in particular from 0.1 to 50 ppm, particularly preferably 0.1 to 20 ppm, are used.

According to the invention, it is also possible for the composition, in addition to the at least one hydrophobin or derivative thereof, to contain further compounds which improve the phase stabilization. These can be all compounds which are known to the person skilled in the art for such applications. For example, suitable further compounds to improve phase stabilization are, in particular, for use as emulsion breakers in crude oil production, oxyalkylated phenol-formaldehyde resins, EO / PO block copolymers, crosslinked diepoxides, polyamides or their alkoxylates, salts of sulfonic acids, ethoxylated fatty amines, succinates and those in DE 10 2005 006 030.7 compounds mentioned for such applications.

Therefore, according to a further embodiment, the present invention relates to a use as described above, wherein in addition to at least one hydrophobin or the at least one derivative thereof, at least one further compound is used which improves the phase stabilization.

According to a further aspect, the present invention also relates to a method for stabilizing liquid phases in a composition containing at least two liquid phases, comprising the addition of at least one hydrophobin or at least one derivative thereof to the composition.

The composition can be a composition as described above containing at least two liquid phases, for example compositions containing oil, preferably crude oil, and water or compositions containing fuel and water.

The method according to the invention can comprise further steps, for example initially carrying out a phase separation or breaking emulsions and then adding hydrophobins to the aqueous phase.

According to the invention, hydrophobins or derivatives thereof can be added to the aqueous phase of a 2-phase system, but also formulations containing fuels. This enables the phases to stabilize or prevents re-emulsification when the formulation comes into contact with water.

It is also advantageous to add hydrophobins or derivatives thereof to crude oil-water phases in order, for example, to prevent the renewed formation of emulsions during transport.

In the context of the present invention, the formulation containing fuels or fuels can contain further additives which are usually contained in such formulations. Suitable additives are mentioned, for example, in WO 2004/087808.

In the context of the present invention, fuels are understood to mean, for example, light, medium or heavy heating oils.

In the context of the present invention, fuels are understood to mean, for example, gasoline fuels, diesel fuels or turbine fuels. Gasoline fuels are particularly preferred.

The additives mentioned are used in amounts which appear suitable for the particular application to the person skilled in the art.

The formulations according to the invention can moreover be combined with other customary components and additives. Carrier oils without a pronounced detergent effect should be mentioned here, for example. Suitable mineral carrier oils are fractions resulting from petroleum processing, such as bright stocks or base oils with viscosities such as, for example, from class SN 500-2000; but also aromatic hydrocarbons, paraffinic hydrocarbons and alkoxyalkanols. Also suitable according to the invention is a fraction known as "hydrocrack oil" and obtained in the refining of mineral oil (vacuum distillate cut with a boiling range of about 360 to 500 ° C., obtainable from natural mineral oil catalytically hydrogenated and isomerized and dewaxed under high pressure). Mixtures of the abovementioned mineral carrier oils are also suitable.

Examples of synthetic carrier oils which can be used according to the invention are selected from: polyolefins (polyalphaolefins or polyintemalolefins), (poly) esters, (poly) alkoxylates, polyethers, aliphatic polyetheramines, alkylphenol-started polyethers, alkylphenol-started polyetheramines and carboxylic acid esters of long-chain alkanols.

Further suitable carrier oil systems are described, for example, in DE-A 38 26 608, DE-A 41 42 241, DE-A 43 09 074, EP-A 0 452 328 and EP-A 0 548 617, which are hereby expressly incorporated by reference.

Other suitable synthetic carrier oils are alkoxylated alkylphenols, as described in DE-A 10 102 913.6.

The carrier oils mentioned are used in amounts which appear suitable for the particular application to the person skilled in the art.

Further customary additives are corrosion inhibitors, for example based on ammonium salts of organic carboxylic acids that tend to form films or on heterocyclic aromatics in the case of non-ferrous metal corrosion protection; Antioxidants or stabilizers, for example based on amines such as p-phenylenediamine, dicyclohexylamine or derivatives thereof or on phenols such as 2,4-di-tert-butylphenol or 3,5-di-tert-butyl-4-hydroxyphenylpropionic acid; other conventional demulsifiers; Antistatic agents; Metallocenes such as ferrocene; Methylcyclopentadienyl manganese tricarbonyl; Lubricity improvers (lubricity additives) such as certain fatty acids, alkenyl succinic acid esters, bis (hydroxyalkyl) fatty amines, hydroxyacetamides or castor oil; and dyes (markers). If necessary, amines are also added to lower the pH of the fuel. The detergent additives mentioned with the polar groups (a) to (i) are usually added to the fuel in an amount of 10 to 5000 ppm by weight, in particular 50 to 1000 ppm by weight. The other components and additives mentioned are added, if desired, in the amounts customary for this purpose.

According to the invention, all fuels known to the person skilled in the art are suitable as fuels and fuels, for example gasoline fuels as they are, for example, in LJIImann's Encyclopedia of Industrial Chemistry, 5th ed. 1990, Volume A16, pp. 719ff. are described. According to the invention, suitable fuels are also diesel fuel, kerosene and jet fuel.

In particular, a petrol with an aromatic content of a maximum of 60, such as. B. a maximum of 42 vol .-% and a maximum sulfur content of 2000, such. B. a maximum of 150 ppm by weight is suitable.

The aromatic content of the gasoline is, for example, 10 to 50, such as. B. 30 to 42% by volume, in particular 32 to 40% by volume. The sulfur content of the gasoline is for example 2 to 500, such as. B. 5 to 150 ppm by weight, or 10 to 100 ppm by weight.

Furthermore, a suitable petrol can, for example, have an olefin content of up to 50% by volume, such as. B. from 6 to 21% by volume, in particular 7 to 18% by volume; a benzene content of up to 5 vol .-%, such as. B. 0.5 to 1.0% by volume, in particular 0.6 to 0.9% by volume and / or an oxygen content of up to 25% by weight, such as. B. up to 10 wt .-% or 1.0 to 2.7 wt .-%, in particular from 1.2 to 2.0 wt .-%.

In particular, such gasoline can be named as an example, which at the same time have an aromatic content of a maximum of 38 vol .-%, an olefin content of a maximum of 21 vol .-%, a sulfur content of a maximum of 50 ppm by weight, a benzene content of a maximum of 1.0 vol .-% % and an oxygen content of 1.0 to 2.7% by weight.

The content of alcohols and ethers in petrol can vary over a wide range. Examples of typical maximum contents are 15% by volume for methanol, 65% by volume for ethanol, 20% by volume for isopropanol, 15% by volume for tert-butanol, 20% by volume for isobutanol and for ethers with 5 or more carbon atoms in the molecule 30% by volume.

The summer vapor pressure of a gasoline suitable according to the invention is usually a maximum of 70 kPa, in particular 60 kPa (in each case at 37 ° C.). The RON of petrol is usually 75 to 105. A common range for the corresponding MON is 65 to 95.

The specified specifications are determined using customary methods (DIN EN 228).

The invention is explained in more detail below by means of examples.

Examples

example 1

Preparatory work for the cloning of yaad-HisJ vaaE-HiSg

A polymerase chain reaction was carried out with the aid of the oligonucleotides Hal570 and Hal571 (Hal 572 / Hal 573). Genomic DNA of the bacterium Bacillus subtilis was used as template DNA. The PCR fragment obtained contained the coding sequence of the yaaD / yaaE gene from Bacillus subtilis, and an Ncol or BglII restriction site at each end. The PCR fragment was purified and cut with the restriction endonucleases Ncol and BglII. This DNA fragment was used as an insert and cloned into the vector pQE60 from Qiagen which had previously been linearized with the restriction endonucleases Ncol and BglII. The resulting vectors pQE60YAAD # 2 / pQE60YaaE # 5 can be used to express proteins consisting of, YAAD :: HIS6 or YAAE :: HIS6 be used.

Hal570: gcgcgcccatggctcaaacaggtactga Hal571: gcagatctccagccgcgttcttgcatac Hal572: ggccatgggattaacaataggtgtactagg Hal573: gcagatcttacaagtgccttttgcttatattcc

Example 2

Cloning of Vaad-Hvdrophobin DewA-HiSg

A polymerase chain reaction was carried out with the aid of the oligonucleotides KaM 416 and KaM 417. Genomic DNA from the mold Aspergillus nidulans was used as template DNA. The PCR fragment obtained contained the coding sequence of the hydrophobin gene dewA and an N-terminal FactorXa proteinase cleavage site. The PCR fragment was purified and cut with the restriction endonuclease BamHI. This DNA fragment was used as an insert and cloned into the vector pQE60YAAD # 2 which had previously been linearized with the restriction endonuclease BglII.

The resulting vector # 508 can be used to express a fusion protein consisting of, YAAD :: Xa :: dewA :: HIS6 be used.

KaM416: GCAGCCCATCAGGGATCCCTCAGCCTTGGTACCAGCGC KaM417: CCCGTAGCTAGTGGATCCATTGAAGGCCGCAT- GAAGTTCTCCGTCTCCGC

Example 3

Cloning of Vaad-Hvdrophobin RodA-HiSg

The cloning of plasmid # 513 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 434 and KaM 435.

KaM434: GCTAAGCGGATCCATTGAAGGCCGCATGAAGTTCTCCATTGCTGC KaM435: CCAATGGGGATCCGAGGATGGAGCCAAGGG

Example 4

Cloning of vaad-Hvdrophobin BASFI-HiSg

The cloning of plasmid # 507 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 417 and KaM 418.

An artificially synthesized DNA sequence - hydrophobin BASF1 - was used as template DNA (see appendix, SEQ ID NO. 11 and 12).

KaM417: CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCG C

KaM418: CTGCCATTCAGGGGATCCCATATGGAGGAGGGAGACAG

Example 5 Cloning of vaad-hydrophobin BASF2-HiSfi

The cloning of plasmid # 506 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 417 and KaM 418.

An artificially synthesized DNA sequence - hydrophobin BASF2 - was used as template DNA (see appendix, SEQ ID NO. 13 and 14).

KaM417: CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCG C

KaM418: CTGCCATTCAGGGGATCCCATATGGAGGAGGGAGACAG

Example 6

Cloning of Vaad-Hvdrophobin SC3-HiSfi

The cloning of the plasmid # 526 was carried out analogously to plasmid # 508 using the oligonucleotides KaM464 and KaM465.

The template DNA used was cDNA from Schyzophyllum commune (see Appendix, SEQ ID NO. 9 and 10).

KaM464: CGTTAAGGATCCGAGGATGTTGATGGGGGTGC KaM465: GCTAACAGATCTATGTTCGCCCGTCTCCCCGTCGT

Example 7

Fermentation of the recombinant E. coli strain vaad-Hvdrophobin DewA-HiSg

Inoculation of 3ml LB liquid medium with a yaad hydrophobin DewA-His6 expressing E. coli strain in 15 ml Greiner tubes. Incubation for 8 hours at 37 ° C. on a shaker at 200 rpm. 2 11 Erlenmeyer flasks with baffles and 250 ml LB medium (+ 100 μg / ml ampicillin) are inoculated with 1 ml each of the preculture and incubated for 9 hours at 37 ° C. on a shaker at 180 rpm.

13.51 LB medium (+ 100μg / ml ampicillin) in a 2Ol fermenter with 0.51 preculture (OD6oonm 1:10 against H2O measured) inoculate. With an OD60nm of -3.5 addition of 140ml 10OmM IPTG. After 3 hours, cool the fermenter to 10 ° C and centrifuge the fermentation broth. Use cell pellet for further purification.

Example 8

Purification of the Recombinant Hydrohobin Fusion Protein

100 g cell pellet (100 - 500 mg hydrophobin) are made up to a total volume of 200 ml with 50 rtiM sodium phosphate buffer, pH 7.5, and resuspended. The suspension is treated with an Ultraturrax type T25 (Janke and Kunkel; IKA-Labortechnik) for 10 minutes and then for 1 hour at room temperature with 500 units of Benzonase (Merck, Darmstadt; Order No. 1.01697.0001) to break down the nucleic acids incubated. Before the cell disruption, a glass cartridge (P1) is used to filter. For cell disruption and for shearing the remaining genomic DNA, two homogenizer runs are carried out at 1,500 bar (Microfluidizer M-110EH; Microfluidics Corp.). The homogenate is centrifuged (Sorvall RC-5B, GSA rotor, 250 ml centrifuge beaker, 60 minutes, 4 ° C, 12,000 rpm, 23,000 g), the supernatant placed on ice and the pellet in 100 ml sodium phosphate buffer, pH 7, 5 resuspended.

Centrifugation and resuspension are repeated three times, the sodium phosphate buffer containing 1% SDS for the third repetition. After resuspension, the mixture is stirred for one hour and a final centrifugation is carried out (Sorvall RC-5B, GSA rotor, 250 ml centrifuge beaker, 60 minutes, 4 ° C., 12,000 rpm, 23,000 g).

According to SDS-PAGE analysis, the hydrophobin is contained in the supernatant after the final centrifugation (Figure 1). The experiments show that the hydrophobin is probably contained in the corresponding E. coli cells in the form of inclusion bodies. 50 ml of the supernatant containing hydrophobin are applied to a 50 ml Nickel-Sepharose High Performance 17-5268-02 column (Amersham) which has been equilibrated with 50 rtiM Tris-Cl pH 8.0 buffer. The column is washed with 50 mM Tris-Cl pH 8.0 buffer and the hydrophobin is then eluted with 50 mM Tris-Cl pH 8.0 buffer containing 200 mM imidazole. To remove the imidazole, the solution is dialyzed against 50 mM Tris-Cl pH 8.0 buffer.

Figure 1 (Figure 1) shows the purification of the hydrophobin produced: Lane A: Application of a nickel-Sepharose column (1:10 dilution)

Lane B: run-through = eluate washing step

Lanes C - E: OD 280 maxima of the elution fractions (WP1, WP2, WP3)

Lane F shows the applied marker.

The hydrophobin in Figure 1 has a molecular weight of approx. 53 kD. The smaller bands partly represent degradation products of the hydrophobin.

Example 9

Application test: Characterization of the hydrophobin by changing the contact angle of a water drop on glass

Substrate:

Glass (window glass, Süddeutsche Glas, Mannheim):

The hydrophobin purified according to Example 8 was used.

- Concentration of the hydrophobin in the solution: 100 μg / ml, the solution also contained 50 rtiM Na acetate buffer and 0.1% polyoxyethylene (20) sorbitan monolaureate (Tween® 20)), pH value of the solution: 4 Immersion of glass plates in this solution overnight (temperature 80 ° C) - Then the hydrophobin-coated glass plate is removed from the solution and washed in distilled water,

Then incubate for 10 min / 80 ° C / 1% SDS solution in distilled water. Again washing in distilled water

The samples are air-dried and the contact angle (in degrees) of a drop of 5 μl of water with the coated glass surface is determined at room temperature.

The contact angle measurement was carried out on a Dataphysics Contact Angle System OCA 15+ device, SCA 20.2.0 software. (November 2002) determined. The measurement was carried out in accordance with the manufacturer's instructions.

Untreated glass gave a contact angle of 30 ± 5 °; That with the hydrophobin according to Example 8 (yaad-dewA-his6) coated glass plates resulted in a contact angle of 75 ± 5 °.

==> Increase in contact angle: 45 °

Example 10

Experiments on phase stabilization by hydrophobin

50 ml of an emulsion of crude oil (homogeneous crude oil, Wintershall AG, Emiichheim, Sonde 60, 64, 83, 87, 301 and 507) and water were placed in each snap-cap jar. The emulsion was produced by emulsifying 1000 ppm of crude oil in approx. 50 ml of water using an Ultraturrax stirrer (stirring time of 4 minutes at 24,000 rpm).

To this emulsion were added

no demulsifier added in case A, 10 ppm hydrophobin from example 8 in case B, 10 ppm polyDADMAC in case C (demulsifier with solids content of 28 to 32% (ISO3251), viscosity 200 to 800 mPas (ISO2595)) in case D 10 ppm Lupasol SK (polyamidoamine grafted with polyethyleneimine, manufacturer Nippon Shokubai, Japan)

The samples were then left to stand for 3 days, the emulsions separating (see schematic illustration in FIG. 2, top row).

The samples were then gently shaken by hand using a few circular motions. In cases A, C and D, strong cloudiness (emulsion formation) resulted again, in the case of B (containing hydrophobin) the phase separation was retained.

Occasionally, flakes also formed in sample B containing 10 ppm of hydrophobin, but these immediately rose to the upper oil phase (see lower row of the schematic illustration in FIG. 2). These experiments show that hydrophobins stabilize the already completed separation of emulsions into two separate phases better than commercial demulsifiers.

The hydrophobin can also be added to the aqueous phase after the emulsion has been split.

Example 11

Comparison of phase stabilization

First, 5% strength by weight solutions of the demulsifiers listed in the table in a xylene / isopropanol mixture 3: 1 (based on volume) are prepared.

The hydrophobin from Example 8 was made up as a 1% solution (0.25% active substance) in distilled water 1 hour before addition.

Examples of demulsifiers used are:

Pluronic® PE 6800: (ethylene oxide / propylene oxide copolymer)

Basorol® P380: (Triol Polyol Polyether)

Basorol® HP: (Tetrol-Ethylene Oxide / Propylene Oxide Copolymer)

A crude oil emulsion (Wintershall AG, Emiichheim, probes 60, 64, 83, 87, 301 and 507 with a water content of 62% by volume, determined according to the DIN ISO distillation method

3733) was placed in a closed container in a water bath on a

Temperature of 52 0C heated.

The crude oil emulsion was homogenized by shaking for about 30 seconds and 100 ml of each crude oil emulsion were filled into 100 ml shaking cylinders. The ones filled with oil

Shake cylinders were placed in the water bath.

Using an Eppendorf pipette, 50 μl of the 5% by weight solution of the above-mentioned demulsifiers were dosed into a shaking cylinder with crude oil emulsion and the cylinder was closed with the glass stopper. The shaking cylinder was then removed from the water bath, shaken 60 times and relaxed. The shaking cylinder was then placed back in the water bath (52 ° C.) and the volume of the water that separated out was read off after 30 and 240 minutes. The results are given in the table below.

After 240 minutes, the amounts of hydrophobin given in the table were each injected into the settled water using a disposable syringe. The mixtures are then shaken for 30 seconds each. The samples are then left to rest at 52 ° C. for 1 minute and the amount of water separated off is then determined. The results are summarized in the table.

table

It can be clearly seen that the addition of the hydrophobin accelerates the renewed separation of the phases. Accordingly, the re-emulsification of the water phase in the oil phase by the protein seems to be reduced.

The low concentration of 0.5 to 1 ppm of hydrophobin, which is sufficient to achieve the result, is also astonishing.

Claims

1. Use of at least one hydrophobin for phase stabilization in compositions containing at least two liquid phases.

2. Use according to claim 1, characterized in that the composition has an aqueous and an organic phase.

3. Use according to one of claims 1 or 2, characterized in that the hydrophobin is a fusion hydrophobin.

4. Use according to one of claims 1 to 3, characterized in that the fusion hydrophobin is at least one selected from the group of yaad-Xa-dewA-his (SEQ ID NO: 20), yaad-Xa-rodA -his (SEQ ID NO: 22) or yaad-Xa-basf1-his (SEQ ID NO: 24), where yaad can also be a shortened fusion partner yaad 'with 20 to 293 amino acids.

5. Use according to one of claims 1 to 4, characterized in that the composition containing at least two liquid phases is a composition containing oil and water or a composition containing fuel or fuel and water.

6. Use according to one of claims 1 to 5, characterized in that the at least one hydrophobin is used in an amount of 0.001 to 80 ppm, based on the total composition.

7. Use according to one of claims 1 to 6, characterized in that it is a crude oil-water composition, and the hydrophobin is used in an amount of 0.001 to 20 ppm, based on the total composition.

8. Use according to any one of claims 1 to 6, characterized in that it is a fuel / water composition, and the hydrophobin is used in an amount of 0.01 to 10 ppm, based on the total composition becomes.

9. Use according to one of claims 1 to 8, characterized in that in addition to the at least one hydrophobin, at least one further compound is used which improves the phase stabilization. 10. A method for stabilizing liquid phases in a composition containing at least two liquid phases, comprising the addition of at least one hydrophobin to the composition.

11. The method according to claim 10, characterized in that the hydrophobin is a fusion hydrophobin or a derivative thereof.

12. The method according to any one of claims 10 or 11, characterized in that the fusion hydrophobin is at least one selected from the

Group of yaad-Xa-dewA-his (SEQ ID NO: 20), yaad-Xa-rodA-his (SEQ ID NO: 22) or yaad-Xa-basf1-his (SEQ ID NO: 24), where it yaad can also be a shortened fusion partner yaad 'with 20 to 293 amino acids.

13. The method according to any one of claims 10 to 12, characterized in that the composition containing at least two liquid phases is a composition containing oil and water or a composition containing fuel and water.

14. The method according to any one of claims 10 to 13, characterized in that the hydrophobin is used in an amount of 0.001 to 80 ppm, based on the total composition.

15. The method according to any one of claims 10 to 14, characterized in that it is a crude oil-water composition, and the hydrophobin is used in an amount of 0.001 to 20 ppm, based on the total composition.

16. The method according to any one of claims 10 to 14, characterized in that it is a fuel / water composition, and the hydrophobin is used in an amount of 0.001 to 20 ppm, based on the total composition.

17. The method according to any one of claims 10 to 16, characterized in that the phases are first split and then the hydrophobin is added to the aqueous phase. 18. Formulation containing at least one organic phase consisting of fuels, fuels and / or crude oils and an aqueous phase containing at least one hydrophobin.

19. Formulation according to claim 18, characterized in that the hydrophobin is contained in the formulation in an amount of 0.001 to 80 ppm, based on the entire formulation.

20. Formulation according to claim 18 or 19, characterized in that the formulation contains at least one fuel and that

Hydrophobin or the derivative thereof is contained in the formulation in an amount of 0.01 to 1 ppm, based on the total formulation.

21. Formulation according to claim 20, characterized in that the fuel is a fuel selected from the group of

Gasoline, diesel or turbine fuels.

22. Formulation according to one of claims 18 to 21, characterized in that the hydrophobin is a fusion hydrophobin or a derivative thereof.

23. Formulation according to one of claims 18 to 22, characterized in that the fusion hydrophobin is at least one selected from the group of yaad-Xa-dewA-his (SEQ ID NO: 20), yaad-Xa-rodA -his (SEQ ID NO: 22) or yaad-Xa-basf1-his (SEQ ID NO: 24), where yaad can also be a shortened fusion partner yaad 'with 20 to 293 amino acids.